Superando el Sida

Información objetiva que desmitifica el Sida


Aqui les voy a explicar para que ustedes mismos puedan comprobar que los primers de arranque de la pcr con los que se mide la carga viral es concretamente genoma humano.  

Se supone que estos primers pertenecen al genoma del vih pero realmente no es asi, estos blast demuestran que nunca llegó a realizarse el aislamiento del supuesto vih y que lo que ellos llaman genoma del vih  es genoma humano:

1.- De este documento oficial del supuesto vih vamos a tomar los primers de arranque:


A) Una vez que tomamos el primer que queremos comparar con la base de datos del genoma humano, copiamos el primer seleccionado y lo llevamos a la base de datos de Homo sapiens (human) Nucleotide BLAST:

nos posicionamos en database y de lado derecho damos click en el cuadro para cambiar a.

"Non-RefSeq RNA"

una vez hecho el cambio pegamos el primer seleccionado en el cuadro:

Enter accession number(s), gi(s), or FASTA sequence(s)  

Hecho esto, por ultimo le damos click en el boton azul con las palabra BLAST y listo:




H.sapiens BH30 mRNA
Alignment statistics for match #1
Score Expect Identities Gaps Strand
40.1 bits(20) 0.002 20/20(100%) 0/20(0%) Plus/Plus
Query  1   TGTGTGCCCGTCTGTTGTGT  20                                                                    |||||||||||||||||||| Sbjct  1   TGTGTGCCCGTCTGTTGTGT  20 

Su nombre de ese primers es:H.sapiens BH30 mRNA

Visitas: 947

Responde a esto

Respuestas a esta discusión

Y no solo los primers de arranque de la pcr-vih son endogenos, tambien los primers de arranque de la hepattis c:


tctgcggaaccggtgagt de la prueba de abbott real time pcr hepatitis c:


Homo sapiens protocadherin Flamingo 2 (FMI2) mRNA, complete cds
Alignment statistics for match #1
Score Expect Identities Gaps Strand
30.2 bits(15) 0.95 15/15(100%) 0/15(0%) Plus/Plus
Query  1    TCTGCGGAACCGGTG  15                                                                                                                                               ||||||||||||||| Sbjct  359  TCTGCGGAACCGGTG  373

Porfa, alguien que nos explique que significa mas o menos ese viaje de letras y la relacion con el seudo VIH. Saludos

Esas letras se llaman secuencias geneticas ( es una sucesión de letras representando la estructura primaria de una molecula real o hipotética de ADN o banda, con la capacidad de transportar informacion), las  letras son ACG, y T, que simbolizan las cuatro subunidades de nucleotidos de una banda ADN - adenina, citosina, guanina,timina, que son bases covalentemente ligadas a cadenas fosfóricas.

Se supone que esas moléculas o primers son los iniciadores de la carga viral, que parten de proteínas como la p55 ó p24 que Roche dice es limitada para captar el VIH. Si los primers no captan el virus puro aislado, la prueba es inválida, ya que el supuesto vih no ha sido aislado ni secuenciado correctamente esa moléculas que utilizan para realizar esa prueba son parte de nuestro genoma humano por eso todas las personas negativas o positivas arrojan un valor cuando se les aplica la prueba.

Cuando se hace la comparación con el blast del genoma humano(Homo Sapiens), con esas moléculas que se supone son del genoma del vih, no debería de haber ninguna coincidencia u homología, pero no es el caso, lo que invalida toda la teoría del vih, al dar como resultado que todas esas secuencias o primer son idénticas al genoma humano.

Por tanto la PCR está siendo usada erróneamente para diagnosticar infecciones, cuando en realidad solo detecta que el paciente es HUMANO.

Encontré igualdad con el genoma humano en los primers de pcr de citomegalovirus, clamidia y hepatitis c.


juancho dijo:

Porfa, alguien que nos explique que significa mas o menos ese viaje de letras y la relacion con el seudo VIH. Saludos

Gracias!!!! pero si puedes publicar mas, seria interesante!!!

Esto es interesantísimo, msl76. Muchísimas gracias. Hasta el momento nadie, que yo sepa, había expuesto el proceso de identificación y comparación genética con tanta claridad. Ahora podemos comprender un poco mejor la magnitud del fraude vih-sida. Aunque ya supiéramos que esto era así, que era genoma humano lo que se estaba vendiendo como vih, la gente de a pie, como el que suscribe, no habíamos tenido la oportunidad de verlo tan claro. Ni que fuera tan 'fácil'? de comprobar. Un abrazo y enhorabuena.

Sin duda los que ignoramos tantos tèrminos debemos adentrarnos en este tema que de entrada me parece muy interesante. Tenemos la responsabilidad de investigar mucho mas que los doctores ya que somos nosotros los etiquetados, se trata de nuestra vida y del futuro...  

Hola..buenas..sobre este tema ya que el hilo está abierto aporto este PDF descargable de esta información interesante:

"Es el estudio publicado en este enlace: (también lo adjunto) donde el bioinformático MIGUEL ROMERO ha encontrado que varias secuencias de letras genéticas (ácido nucleico) y de aminoácidos (proteínas) oficialmente atribuidas al supuesto "VIH" como supuestamente específicas, aparecen repetidas, al 90 o más por ciento, y decenas de veces, en bases de datos públicas que contienen secuenciaciones no sólo de hongos y otros microbios sino incluso de cromosomas del Homo Sapiens y de huesos fósiles del Homo Sapiens Neanderthalensis... es decir, ¡del Hombre de Neandertal!"

Os adjunto el PDF ...


Archivos adjuntos

Gracias Lobish, de todos modos, ya que es una información de bastante interés, la publicaremos también en los blogs.

Lobishome Romasanta dijo:

Hola..buenas..sobre este tema ya que el hilo está abierto aporto este PDF descargable de esta información interesante:

"Es el estudio publicado en este enlace: (también lo adjunto) donde el bioinformático MIGUEL ROMERO ha encontrado que varias secuencias de letras genéticas (ácido nucleico) y de aminoácidos (proteínas) oficialmente atribuidas al supuesto "VIH" como supuestamente específicas, aparecen repetidas, al 90 o más por ciento, y decenas de veces, en bases de datos públicas que contienen secuenciaciones no sólo de hongos y otros microbios sino incluso de cromosomas del Homo Sapiens y de huesos fósiles del Homo Sapiens Neanderthalensis... es decir, ¡del Hombre de Neandertal!"

Os adjunto el PDF ...


muy importante este documento , no lo he leido, pero solo el resumen me caigo de la silla, por la CANDIDA !!!!! y Cryptococcus en wikipedia :

Cryptococcus , cuyo significado es "esfera oculta", es un género de fungi. Las especies crecen en cultivo como levaduras. Las formas perfectas (sexuales) o teleomorfas de las especies de Cryptococcus son hongos filamentosos en el género Filobasidiella. El nombre Cryptococcus se usa al referirse a las formas imperfectas (estado de levadura) del hongo.

Tinción que muestra especies deCryptococcus en tejido pulmonar

Cryptococcus neoformans es la especie más importante desde el punto de vista médico. Es mejor conocido por causar una severa forma de meningitis y meningo-encefalitis en personas con HIV/SIDA.

cada día que me asomo por aquí acabo mas cabreadoo jejej gracias Lobishome Romasanta.

espectacular trabajo, muy interesante, pone a los oficialistas en donde el diablo perdio los calzones, cada vez se pone mas de manifiesto que todo ha sido creado para hacer el mal y veneficiarse de la salud de los demas, cuando esto esplote, rodaran muchas cabezas, entonces el mundo mirara para los afectados de otra manera y se daran cuenta de por que se ha luchado tanto para que la verdad salga la luz, esto solo lo sabe el que lo ha pasado en sus propias carnes, en el cual yo me incluyo, salud y fuerza para todos.

Responder a debate



Esta web tiene un carácter ABIERTO, por lo que recomendamos no usar tu verdadero nombre al registrarte para preservar mejor tu anonimato, ESTO ES MUY IMPORTANTE TENERLO EN CUENTA,  TU NOMBRE Y APELLIDOS, ASÍ COMO LOS COMENTARIOS QUE HACES AQUÍ, PUEDEN SALIR EN INTERNET


Unirte es aceptar las

normas de uso de la red


Contactos personales:

habilitamos un espacio, ligado a ésta red social :

© 2017   Creado por Manuel Garrido Sotelo.   Tecnología de

Emblemas  |  Reportar un problema  |  Términos de servicio